What is the main difference between Mycobacterium leprae and M. tuberculosis?
A) M. tuberculosis has half the genes of M. leprae
B) M. leprae affects humans while M. tuberculosis does not
C) M. leprae has half the genes of M. tuberculosis
D) They are descended from different ancestors
What is not true about UPGMA and Neighbor-joining approaches?
A) Neighbor-joining clusters sequences which minimise total tree-branch length
B) UPGMA clusters OTUs that are most similar
C) Neighbor-joining begins with a “star” tree
D) Neighbor-joining requires a distance matrix while UPGMA does not
What is the “Fast-X effect”?
A) suppression of X expression in the male germline
B) an enrichment in loci that cause hybrid incompatibilities on the X chromosome
C) an increase in the rate of adaptive evolution on the X chromosome
D) upregulation of the single X chromosome in male somatic tissue approximately two-fold
What is the effective population size of humans?
A) Approximately 12,500
B) Approximately 1,250,000
C) Approximately 125,000,000
D) Approximately 125,000
Flower development in plants is controlled by which genes?
A) mc1r
B) homeobox (Hox)
C) MADS-box
D) Pax6
The expected proportion of changes (k) between two DNA sequences can be calculated as (note: d = observed proportion of differences):
A) k = 3/4 ln (1-4d/3)
B) k = 3/4 ln (1+4d/3)
C) k = -3/4 ln (1-4d/3)
D) k = -3/4 ln (1+4d/3)
Which of these techniques uses a distance matrix?
A) maximum likelihood
B) Bayesian interference
C) neighbor-joining
D) maximum parsimony
In protein evolution, what does the statistic D tell us?
A) the rate of substitution
B) the expected proportion of differences between two protein sequences
C) the proportion of sequences not changing over time
D) the proportion of differences between two protein sequences
The homeodomain is a protein domain of … amino acids?
A) 60
B) 120
C) 40
D) 180
What do we call a codon where a base change causes no change in the amino-acid produced?
A) a stop codon
B) non-degenerate
C) four-fold degenerate
D) two-fold degenerate
Variation in which human gene is supposedly associated with the “risk taking”?
A) LCT
B) AMY
C) DRD4
D) CCR5
What is a clade?
A) a paraphyletic group
B) a phenetic taxon
C) a monophyletic group
D) a polyphyletic group
Which of the following could explain the obeserved positive correlation between DNA polymorphism and recombination rate?
A) Dominance
B) Neutral theory
C) Overdominance
D) Genetic hitchhiking
What is the following result in a MK (McDonald-Kreitman) test indicative of?
A) Balancing selection
B) Neutral protein evolution
C) Weak purifying selection
D) Positive selection for amino-acid changes
Invertebrates have … Hox genes?
A) 16
B) 4
C) 1
D) 8
What is not true about the domestication of dogs?
A) Domestication of dogs began at least 15,000 years ago.
B) Dogs are most closely related to wolves.
C) Mitochondrial DNA suggests East Asian dogs are probably the oldest clade of domesticated dogs.
D) Most studies suggest dogs were domesticated independently in the Americas.
On average, the most divergent proteins between human and chimpanzee are those expressed in the:
A) testes
B) kidneys
C) blood
D) brain
When was protein sequencing first invented?
A) 1960s
B) 1950s
C) 1970s
D) 1980s
Match the models of human evolution with their assumptions
A) 1-C, 2-B, 3-A
B) 1-B, 2-A, 3-C
C) 1-A, 2-C, 3-B
D) 1-A, 2-B, 3-C
(A) 1-C, 2-B, 3-A
Suppression of the X chromosome occurs:
A) in males and females
B) in females, in the ovaries
C) in males, thorughout the entire body
D) in males, in the testes
What does observed F_ST range between in humans?
A) 0.05 - 0.15
B) 0.025 - 0.05
C) 0.5 - 1
D) 0.15 - 0.3
The mutation responsible sickle-cell anaemia (and malaria resistance) occurs in:
A) an exon
B) a 3’ UTR
C) a 5’ UTR
D) an intron
The homeobox is a highly conserved region of … bp?
A) 40
C) 60
(D) 180
homeobox: DNA, 180bp
homeodomain: protein, 60aa
How many base pairs (bp) are in 1 Gb?
A) 1000,000
B) 1000,000,000
C) 10,000
D) 1000
(B)
1Gb = 1,000Mb = 1,000,000Kb = 1,000,000,000bp
Which of the follwing is expected for a pseudogene?
A)Ka/Ks = 0
B) Ka/Ks = 1
C) Ka/Ks < 1
D) Ka/Ks > 1
What does Tajima’s D test for?
A) differences in the ratio of polymorphism to divergence
B) differences in the ratio of polymorphism to divergence at synonymous and nonsynonymous sites
C) frequency spectrum of segregating sites
D) expected proportion of differences
Ovary-specific genes are:
A) over-represented on the X chromosome
B) up-regulated in the female germline
C) under-represented on the X chromosome
D) only present on the X chromosome
How many haplotypes are present in the following sequence data?
A) 3
B) 2
C) 4
D) 1
(A) 3
What is the “large-X effect”?
A) upregulation of the single X chromosome in male somatic tissue approximately two-fold
C) suppression of X expression in the male germline
D) an increase in the rate of adaptive evolution on the X chromosome
According to Haldane’s rule, which sex suffers more from hybrid incompatibilities?
A) heterogametic
B) female
C) male
D) homogametic
Which order best represents the current understanding of human migration, from earliest presence of humans to latest presence of humans?
A) Africa > Europe > North America > South America > SE Asia / Australia
B) Europe > Africa > SE Asia / Australia > North America > South America
C) SE Asia / Australia > Europe > Africa > South America > North America
D) Africa > SE Asia / Australia > Europe > North America > South America
What is not true about synonymous substitutions?
A) Ks is the number of synonymous substitutions divided by the total number of synonymous sites
B) they are also calles “replacements”
C) synonymous codons are not used with equal frequency
D) they change the DNA sequence but not the amino-acid produced
The fact that genome length is not correlated with organismic complexity is known as:
A) Haldane’s rule
B) the c-value paradox
C) the g-value paradox
D) the genomic paradox
What amino acid do all proteins begin with?
A) Proline (Pro)
B) Glycine (Gly)
C) Methionine (Met)
D) Tryptophan (Trp)
(C) Methionine (AUG)
On average, the least divergent proteins between human and chimpanzee are those expressed in the:
A) brain
B) blood
C) testes
D) kidneys
Which of these organisms has the largest genome?
A) onion
B) diatom
C) amoeba
D) gorilla
What is not true about protein evolution when compared to DNA evolution?
A) proteins are generally more conserved
B) protein evolution is typically simpler than DNA evolution
C) proteins are easier to align and compare between species
D) protein sequences are simpler than DNA sequences
A) Positive selection for amino-acid changes
C) Balancing selection
D) Weak purifying selection
The Drosophila homologue of the mammalian Pax6 gene is known as:
A) Dax6
B) eyeless
C) white
D) Fmr1
(B) eyeless
vertebrate homolog of the eyeless gene in fruit flies is known as Pax6: mutations in Pax6 lead to defects in eye development in both mice and humans: suggestes that this gene has a conserved function in eye development
What is the definition of a paralogue?
A) a sequence that is homologous due to gene duplication
B) a sequence that is similar due to shared ancestry
C) a sequence that is homologous due to speciation
D) a sequence that evolved in parapatry
What is true about “Mitochondrial Eve”
A) She is the last common ancestor of our mitochondrial genome
B) She was European
C) She was the only woman of her time to have children
D) She is our last common ancestor
(A) She is the last common ancestor of our mitochondrial genome
Which sequencing method involves the use of mapped BAC clones?
A) clone-by-clone
B) Sanger sequencing
C) RNA sequencing
D) shotgun sequencing
Connect the possible outcomes of gene duplication with the correct terms.
A) 1-C, 2-D, 3-A, 4-B
B) 1-B, 2-C, 3-D, 4-A
C) 1-D, 2-A, 3-B, 4-C
D) 1-A, 2-B, 3-C, 4-D
Methods to determine the sequences of DNA were first developed in the:
What is not a possible cause of a negative value of Tajima’s D? (D < 0)
A) Population admixture
B) Purifying selection
C) Recovery after a selective sweep
D) An expanding population
What does a positive value of Tajima’s D indicate? (D > 0)
A) An excess of high-frequency variants
B) An excess of intermediate-frequency variants
C) Neutrality
D) An excess of low-frequency variants
Variation in the level of starch in the human diet is positively correlated with what kind of variance in the amylase enyme gene?
A) copy number variation
B) inversion
C) single-nucleotide polymorphism
D) deletion
(A) copy number variation
copy number variation: when a gene is present in different numbers of copies in different individuals
positive correlation between AMY1 gene copy number and amount of starch in the diet
Which statement is true regarding the differences between cis-acting and trans-acting factors?
A) cis-acting factors usually encode transcription factors, trans-acting factors do not
B) cis-acting factors usually affect many genes, trans-acting factors usually affect only one gene
C) cis-acting factors are physically linked to the gene they regulate, trans-acting factors are not
D) trans-acting factors are more free to evolve, cis-acting factors are more evolutionary constrained
(C) true
cis -> linked to target gene, close by on the same chromosome
trans -> not linked to target gene
(A) wrong, trans-acting factors usually encode transcription factors
(B) wrong, cis-acting factors are linked to the gene that they regulate, typically changes in cis-acting sequences only directly affect the expression of one gene; trans-acting factors may regulate many different genes on many different chromosomes, changes in trans-acting sequences may affect the expression of many genes
(D) cis-regulatory changes are more independent and can lead to new expression patterns that don’t interfere with other functions of the target gene
What is not true about the H2 form of the polymorphic chromosome 17 inversion in humans?
A) H2 is probably the derived form
B) H2 is rare in most populations, except for in Europe
C) Women with H2 have more children, on average
D) H2 is probably the ancestral form
(A) H2 is probably the derived form
B: true
C: true (for icelanders because tested on them)
D: true: summary=Recently, it was found that the H2 inversion is also present in chimpanzee and orangutan (where it is also polymorphic with H1). It is now thought that H2 is the ancestral form and an inversion to H1 occurred independently in human, chimp, and orangutan. Perhaps selection favored H1 in ancestral populations, but later favored H2 in Europe?
Given the distance matrix below, use the UPGMA method to draw a tree and then order sequences A, B, C and D from least derived (basal) to most derived.
A
B
C
D
-
0.30
0.32
0.40
0.08
0.20
0.22
A) B, C, D, A
B) D, C, B, A
C) A, B, C, D
D) A, D, C, B
If the observed proportion of differences (D) between two protein sequences is 0.42, the expected proportion of differences (K) is:
A) 0.32
B) 0.40
C) 0.42
D) 0.54
E) 0.84
(D) 0.54
Because K is a little bit larger than D: don’t need a calculator
If all nucleotides are used with equal frequency, the maximum divergence we expect between two DNA sequences is:
A) 0%
B) 25%
C) 50%
D) 75%
E) 100%
(D) 75%
If all amino acids are used with equal frequency, we expect two random protein sequences to be … identical:
A) 1%
B) 5%
C) 12%
D) 20%
E) 25%
(B) 5% (20 different amino acids: 1/20 = 5%)
Which type of site is expected to show the least divergence between species?
A) non-degenerate
B) 2-fold degenerate
C) 3-fold degenerate
D) 4-fold degenerate
E) 5-fold degenerate
(A) non-degenerate
In Drosophila, sex chromosome dosage compensation involves:
upregulation of the male X
inactivation of one female X
Downregulation of the female autosomes
Downregulation of the male autosomes
1) upregulation of the male X
Which of the following DNA sequence changes is a transition?
A) A -> T
B) C -> T
C) C -> A
D) G -> C
E) G -> T
(B) C -> T
aber auch G -> A, A -> G, T -> C
Which of the following represents a typical value of the transition/transversion ratio for DNA substitutions?
A) 0
B) 0.25
C) 0.50
D) 1.00
E) 2.00
(E) 2.00
(more transitions than transversion so >1)
The ratio dN/dS is also sometimes referred to as:
A) Alpha
B) Delta
C) Kappa
D) Tao
E) Omega
(E) Omega
Which of the following is expected for a pseudogene?
A) dN/dS < 0
B) dN/dS = 0
C) 0 < dN/dS < 1
D) dN/dS = 1
E) dN/dS > 1
(D) dN/dS = 1
According to the molecular clock, sequence divergence between species depends on:
A) The number of generations since their last common ancestor
B) The number of years since their last common ancestor
C) The average mutation rate of the species
D) The average effective population size of the species
E) The harmonic mean of the census population size of the species
(B) The number of years since their last common ancestor
Methods for determining the amino acid sequence of proteins were developed in the:
A) 1920’s
B) 1930’s
C) 1940’s
D) 1950’s
E) 1960’s
(D) 1950s
The most parsimonious tree is the one that:
A) Requires the fewest sequence changes
B) Minimizes the distance matrix
C) Maximizes the distance matrix
D) Has the lowest p-value
E) Has the lowest bootstrap value
(A) Requires the fewest sequence changes
Which one of the following statements about the great apes is correct?
A) Because they are so closely related, it is not possible to determine the phylogeny of the great apes.
B) Bonobo is an outgroup to human and chimpanzee.
C) Gorilla is more closely related to chimpanzee than to human.
D) Human is more closely related to gorilla than to chimpanzee.
E) Some parts of the human genome are more similar to gorilla than they are to chimpanzee.
(E) Some parts of the human genome are more similar to gorilla than they are to chimpanzee.
Which of the following represents a rare genetic change (RGC)?
A) Point mutation
B) Transition
C) Transversion
D) Intron gain
E) Parsimony informative site
(D) Intron gain
Which of the following statements about mammalian mitochondrial DNA is true?
A) It has a higher recombination rate than nuclear DNA
B) It is paternally inherited
C) It is maternally inherited
D) It cannot be used for phylogenetic analysis
E) It is transmitted horizontally among individuals
(C) It is maternally inherited
Mexican and South American dog breeds:
A) Were domesticated in the Americas from American wolves
B) Were brought to the Americas by Europeans after 1492
C) Were brought to the Americas by Vikings before 1492
D) Were derived from domesticated dogs brought to the Americas from Asia
E) Are hybrids between modern Asian and European dog breeds
(D) Were derived from domesticated dogs brought to the Americas from Asia
According to the neutral theory of molecular evolution, both divergence between species and polymorphism within species depend on:
A) The census population size
B) The effective population size
C) The recombination rate
D) The neutral mutation rate
E) The generation time
(D) The neutral mutation rate
A negative value of Tajima’s D is expected when there is:
A) Population expansion
B) Pseudogenization
C) Non-disjunction
D) Whole genome duplication
E) Balancing selection
(A) Population expansion
What is the major difference between the HKA (Hudson-Kreitman-Aguade) and the MK (McDonald Kreitman) tests?
A) The HKA test requires an outgroup species
B) The MK test requires a protein-coding gene
C) The HKA test requires a distance matrix
D) The MK test requires a pseudogene
E) The HKA test requires a pseudogene
(B) The MK test requires a protein-coding gene
Which of the following statements is true of background selection?
A) It has the greatest effect in regions of low recombination
B) It has the greatest effect in regions of high recombination
C) It has the greatest effect when there is strong positive selection
D) It does not affect levels of genetic variation
E) It relies solely on genetic drift
(A) It has the greatest effect in regions of low recombination
According to the fossil record, which was the first hominin to leave Africa?
A) Homo sapiens
B) Homo neanderthalensis
C) Homo denisovensis
D) Homo erectus
E) Homo habilis
(D) Homo erectus
Which of the following statements about Mitochondrial Eve is true?
A) She was the first female Homo sapiens
B) She was the only female to survive the last ice age
C) She had a great granddaughter
D) She was the only female of her generation to reproduce
E) She was the only female of her generation to have a daughter
(C) She had a great granddaughter
A mutation in the CCR5 gene is associated with:
A) Risk-taking behavior
B) Alcohol tolerance
C) Nomadic lifestyle
D) Body Mass Index (BMI)
E) Resistance to HIV/AIDS
(E) Resistance to HIV/AIDS
What type of genetic variation is associated with number of children in the Icelandic population?
A) Gene copy number
B) Synonymous SNP
C) Nonsynonymous SNP
D) Microsatellite repeat number
E) Chromosomal inversion
(E) Chromosomal inversion
Clone-by-clone genome sequencing is also known as … genome sequencing?
A) Hierarchical
B) Next-generation
C) Long-read
D) Sanger
E) Shotgun
(A) Hierarchical
What type of species has the largest known genome?
A) Bacteria
B) Amoeba
C) Diatom
D) Insect
E) Vertebrate
(B) Amoeba
Which of the following methods are used for gene expression profiling?
A) Shotgun sequencing and primer walking
B) RAD-seq and mass spectrometry
C) RNA-seq and microarrays
D) CRISPR-Cas and RNAi
E) Microsequencing and cDNA-probing
(C) RNA-seq and microarrays
Who is known for the hypothesis “ontogeny recapitulates phylogeny”?
A) Charles Darwin
B) R. A. Fisher
C) Motoo Kimura
D) Thomas Hunt Morgan
E) Ernst Haeckel
(E) Ernst Haeckel
The key genes that control flower development in plants are:
A) OR genes
B) NB-LRR genes
C) Hox genes
D) MADS-box genes
E) FLORETTE genes
(D) MADS-box genes
The defining feature of a cis-regulatory variant is that it:
A) Alters the tissue is which a gene is expressed
B) Only has an effect in heterozygotes
C) Affects expression differently in males and females
D) Is genetically linked to the gene it regulates
E) Leads to the creation of a new splicing site
(D) Is genetically linked to the gene it regulates
Which pair of species/taxa are male-heterogametic?
A) Drosophila and honeybee
B) Drosophila and human
C) Honeybee and chicken
D) Human and chicken
E) Anolis lizard and sea turtle
(B) Drosophila and human
In the male germline of Drosophila melanogaster:
A) Expression of the X chromosome is suppressed relative to the autosomes
B) The X chromosome is enriched with male-biased genes relative to the autosomes
C) The X chromosome is completely inactivated
D) X-chromosomal gene expression is up-regulated approximately two-fold
E) X-chromosomal gene expression is up-regulated approximately four-fold
(A) Expression of the X chromosome is suppressed relative to the autosomes
What is the nucleotide divergence (d)?
What is the expected proportion of differences (k)?
Seq1: G A G T G T G C A C T G C A C G A C G A
Seq2: G A G T A T G C A G T G C A C A A T G A
d = 4 / 20 = 0.2
k = -3/4 ln(1 - 4d/3) = 0.233
Below is a DNA sequence alignment. Each sequence comes from a different individual from within the same species.
What is the number of segregating sites (S)?
How many of the polymorphic sites involve transitions?
How many of the polymorphic sites involve transversions?
How many haplotypes are there?
segregating sites (S) = 6
transitions = 4
transversion = 2
haplotypes = 4
Below is an alignment of 20 nucleotide sites from human, chimpanzee, gorilla and orangutan. The orangutan is the outgroup.
How many of the nucleotide sites are “parsimony informative”?
parsimony informative sites = 8
Methods for DNA-sequencing were developd in: ___
1970
Homolog of Pax6 in invertebrates: ___
eyeless
negative value of Tajima’s D suggests excess of: ___
rare variants (?)
Human gene associated with ‘risk-taking’
DRD4
Consequences of chromosome 17 inversion in Iceland
number of children increased
Expected proportion of difference in DNA sequence
-3/4 ln(1-4d/3) -> welche Formel ist das?
Haplotype test: Below is a DNA sequence alignment. Each sequence comes from a different individual from within the same species.
What is the number of segregating sites?
How many of the segregating sites involve transitions?
How many of the segregating sites involve transversions?
Für welchen Test wäre dieser Input nicht geeignet: Tajimas D / Hudsons haplotype test / Haplotype number test / MK Test
haplotypes = 3
1970s
The expected proportion of changes (k) between two DNA sequences can be calculated as: (note: d = observed proportion of differences):
k= -3/4 ln (1-4d/3)
Which value for the proportion of differences is expected for a pseudogene?
Ka/Ks = 1
The mutation responsible for sickle-cell anaemia (and malaria resistance) occurs in:
an exon
Variation in which human gene is supposedly associated with "risk taking"?
What could explain the observed correlation between DNA polymorphism and recombination rate?
Genetic hitchhiking
the testes
According to Haldane's rule, which sex suffers more from hybrid incompatibilities?
heterogametic
8
1950s
A monophyletic group
Methionine (Met)
the proportion of differences between two protein sequences
Variation in the level of starch in the human diet is positively correlated with what kind of variance in the amylase enzyme gene?
copy number variation
MADS-box
neighbor-joining
1) AACTGTGCACTGCATGATGA
2) AACTGTGCACTGCATGATGA
3) AAGTGTGCACTGCCTGATGA
4) AAGTGTGCACTGCCTGATGA
5) AACTGTGCACTGCATGATGA
6) AACTGTGCACTGCATGATGA
7) AACTGTGCACTGCATGCTGA
8) AACTGTGCACTGCATGATGA
3
What does Tajima's D test for?
frequency spectrum of segregating sites
four-fold degenerate
180
the c-value paradox
How many base pairs (bp) are in 1Gb?
1,000,000,000
clone-by-clone
a sequence that is homologous due to gene duplication
What does a positive value of Tajima's D indicate? (D > 0)
An excess of intermediate-frequency variants.
Divergence
Polymorphism
Synonymous
26
21
Nonsynonymous
36
2
X2 = 16.5, P = 0.00003
a) Balancing selection
b) Neutral protein evolution
c) Weak purifying selection
d) Positive selection for amino-acid changes
12
10
4
P = 0.67
A, D, C, B
1) Candelabra model
A) modern humans evolved in Africa and replaced all other species present on other continents without interbreeding
2) Multiregional model
B) modern humans evolved from H. erectus but with gene flow between populations in Europe, Asia and Africa
3) Out-of-Africa model
C) modern humans evolved from H. erectus independently in Europe, Asia and Africa without gene flow
1-C, 2-B, 3-A
Africa > SE Asia/Australia > Europe > North America > South America
Approximately 12,500
What does observed FST range between in humans?
0.05-0.15
brain
M. leprae has half the genes of M. tuberculosis
1) one copy becomes dispensable, loses function via mutation
A) neofunctionalisation
2) selection favours keeping multiple copies of the gene to increase expression
B) subfunctionalisation
3) one copy gains a new function favoured by selection for a beneficial mutation
C) pseudogene
4) original gene has two functions, one function is lost in each copy by mutation, leading to both being required for functionality
D) copy number variation
1-C, 2-D, 3-A, 4-B
What is the "large-X effect"?
an enrichment in loci that cause hybrid incompatibilities on the X chromosome
over-represented on the X chromosome
in males, throughout the entire body
What is the measure of selective constraint on a protein and what does its outcome indicate?
KA/KS=dN/dS=ω
KA/KS<1 : negative selection against amino acid changes
KA/KS=1 : (neutral mutation rate for both KA and KS) amino acid sequence under no selective constraint --> expected for pseudogenes
KA/KS>1 : positive selection against amino acid changes, rare, e.g. HIV, Influenza virus
What is overdominance?
Overdominance is heterozygote advantage --> heterozygous individuals have a higher fitness than homozygous individuals
e.g. human's sickle cell anemia
What is selective sweep?
Reduction or elemination of variation among nucleotides near a mutation --> results from a beneficial allele (when newly appeared mutations are advantageous & increase in frequency) having recently reached fixation due to strong positive natural selection
What is genetic hitchhiking?
An allele changes its frequency (it itself is not under natural selection) due to the close proximitiy to a gene that is undergoing a selective sweep --> thus any other nearby polymorphism (that are in LD) will tend to change allele frequency too
==> neutral or slightly deletirious alleles close by hitchhike with the sweep
What does Haldane's rule say?
During early stage of speciation: If in a species hybrid only one sex is steril, that sex is more likely to be the heterogametic sex
What are homeoboxes and homeodomains?
- DNA sequence ~180bp long, found within genes, that are involved in the regulation of patterns of anatomical development in animals, fungi & plants
- These genes encode homeodomain protein products that are transcription factors sharing a characteristic protein fold structure that binds DNA
What are possible outcomes for Tajima's D?
D=0 : neutral expectation
D<0 : excess of low frequency variants (e.g through purifying selection keeping deleterious mutations at low frequency; expanding population e.g. after bottleneck; recovery of variation after selective sweep)
D>0 : excess of intermediate frequency variants (e.g. through balancing selection; population admixture)
Two key predictions of the neutral theory:
1) Divergence between species: K=µ (µ=neutral evolution rate)
2) Heterozygosity within species: θ=4Neµ
Explanation of the following table:
1) Divergence = between species
Polymorphism = within a species
2) if nonynonymous changes are > than synonymous changes in divergence column
= positive selection
3) if nonynonymous changes > larger than synonymous changes in polymorphism column = balancing selection (or weak purifying selection?)
4) if the P value is > 0.05 then the whole table is insignificant = its following the neutral theory
5) if P value is < 0.05 you can reject the null hypothesis of neutrality
What are segregating sites?
Positions which show differences (polymorphisms) between related genes in a sequence alignement [mutations included]
What is Copy-number variation?
Sections of the genome are repeated and the number of repeats in the genome varies between individuals in the human population (type of duplication/deletion event)
E.g. in mammals: copy number variations play an important role in generating necessary variation in the population as well as disease phenotype
What is a haplotype?
Group of alleles in an organism that are inherited together from a single parent
Also: cluster of tightly linked genes on a chromosome
Also: set of linked single-nucleotide polymorphism (SNP) alleles that tend to always occur together
What is a standard measure of the degree of genetic differentiation in a total population and its subpopulations?
Wright's FST with values between 0 and 1
FST=0 : sequences within and among subpopulations have the same average number of differences = high level of gene flow
FST=1 : all differences are between subpopulations = low level of gene flow
Advantages of mitochondrial DNA compared to nuclear DNA
1) single locus
2) no recombination
3) maternally inherited
4) fastly evolving (more than 10x faster than nuclear genes)
5) small genomen (easier to work with)
Three main trends in adaptive evolution in hominin lineage:
1) Bipedality
2) Brain enlargement (from 400cm3 to 1400cm3)
3) Social behaviour
Methods to determine the amino acid sequence of a protein were developed in the:
A) 1950’s
B) 1960’s
C) 1970’s
D) 1980’s
Which of the following requires an “outgroup” sequence?
a) Haplotype number test
b) Relative rate test
c) Tajima’s D test
d) Hudson’s haplotype test
Which of the following requires a protein-coding sequence?
a) HKA (Hudson-Kreitman-Augade) test
b) Tajima’s D test
c) MK (McDonald-Kreitman) test
Which of the following would suggest positive selection?
a) Ka/Ks > 1
b) Ka/Ks = 0
c) Ka/Ks < 1
d) Ka/Ks = 1
A positive value of Tajima’s D suggests an excess of:
a) Common variants
b) Rare variants
c) Synonymous variants
d) Non-synonymous variants
What type of variation in the Amylase gene is associated with starch digestion in humans?
a) SNP variation
b) Microsatellite repeat variation
c) Copy number variation
d) cis-regulatory variation
The mutations responsible for lactase persistence in European and African pastoralist populations occurred:
a) In a shared African ancestor
b) In a shared European ancestor
c) In the human-chimp ancestor
d) Independently in the 2 populations
A deletion in which gene is associated with HIV/AIDS resistance in humans?
a) G6PD
b) CCR5
c) DRD4
d) LCT
Which of the following can explain the observed positive correlation between DNA polymorphism and recombination rate?
a) Overdominance
b) Genetic hitchhiking
c) Neutral theory
d) Dominance
Which model of human evolution involves extensive gene flow among populations?
a) Candelabra model
b) Multiregional model
c) Replacement model
d) Adaptive model
The vertebrate homolog of the Drosophila eyeless gene is known as:
a) Pax6
b) FOXP2
d) CCR5
a) OR genes
b) NB-LLR genes
c) Hox genes
d) MADS-box genes
Which method can be used for PTGS (post-transcriptional gene silencing)?
a) CRISPR-Cas9
b) Homologous recombination
c) RNA inference
The Scala Naturae refers to
a) Carl Linneaus’ binomial classification system.
b) Aristotele’s’ hierarchical organization of organismal life.
c) The basis of the medieval ‘Chain of Beings’.
d) The Darwinian (population level) scale at which natural selection acts.
Consider two biallelic loci A and B. Which of the following notation refers to a haplotype?
a) A1A2
b) B1B1
c) A1A2,B1B1
d) A1B1
In female heterogametic species like birds the mutation rate of the Z chromosome compared to autosomes is expected to be
a) Higher
b) Lower
c) Equal
d) 1/3
Two alleles A and a segregate at a single bi-allelic locus. Assuming finite population size, random mating and no selection, the A allele will eventually be
a) Fixed
b) Either lost or fixed
c) Preserved
d) At equilibrium
Which of the following statements is correct? Linkage disequilibrium
a) Increases the level of heterozygosity in each of the loci under consideration.
b) Cannot occur because of genetic drift.
c) Diminishes as a function of time and recombination rate.
d) Is independent of gene genealogies
You calculate F-statistics for a set of two subpopulations in a diploid organism. In subpopulation 1 you find FIS to be positive. What does that mean?
a) Allele frequencies differ between subpopulations.
b) There is evidence for migration from subpopulation 1 into subpopulation 2.
c) The number of heterozygotes in subpopulation 1 is lower than expected under Hardy-Weinberg-equilibrium.
d) The number of heterozygotes in subpopulation 1 is higher than expected under Hardy-Weinberg-equilibrium.
What does the Wahlund effect refer to?
a) The fact that selection is more efficient in large populations.
b) The reduction of heterozygosity in a population due to population substructure.
c) The effect of recombination on trait variation.
d) The reduction in effective population size due to gender-specific variance in reproductive success.
Which of the following conditions would most likely lead to an increase in the frequency of altruistic behavior in a population?
a) Groups that differ in terms of altriostic and selfish genotypes have differential reproduction survival
b) The altruistic behavior benefits the population
c) The rate of extinction of the selfish genotype is high
d) The beneficiaries of the behavior are related to the individual performing it.
In a diploid population with alleles A and a the aa genotype has a selective disadvantage (s) of 40%. The dominance coefficient (h) in heterozygotes is 0.3. What is the fitness of the three genotypes?
a) wAA = 1, wAa = 0.58, waa = 0.6
b) wAA = 0.6, wAa = 0.3, waa = 1
c) wAA = 1, wAa = 0.82, waa = 0.4
d) wAA = 1, wAa = 0.88, waa = 0.6
One obligate cross-over per chromosome arm is required for successful meiosis. Consider an organism with 23 metacentric chromosomes. What is the minimum genetic map length of the genome?
a) 23cM
b) 2300cM
c) 1150cM
d) 230cM
Using a linear regression of the phenotypic values of the offspring over the mean of the two parental phenotypic values we can estimate:
a) H^2 = V_G / V_P, assuming the parents are not related
b) H^2 = V_A / V_P, assuming the parents are not related
c) H^2 = V_A / V_P, assuming the parents and offspring environments are not correlated
d) H^2 = V_G / V_P, assuming the parents and offspring environments are not correlated
The biological species concept is useful because
a) There are no exceptions
b) It emphasizes the role of reproductive isolation
c) It includes asexual species
d) It is easy to test
Draw a 2-dimensional model of evolution after a) Carolus Linnaeus, b) Jean-Baptiste Lamarck, c) Charles R. Darwin. Use “time” for the y-axis and “species” for the x-axis in all cases.
You sample 20 genotypes each from two populations. Genotyping each individual with a co-dominant molecular marker you infer the following genotype frequencies:
What are the allele frequencies p1 and p2 for the A allele in population 2 and 2 repectively?
p1 = 0.5
p2 = 0.2
What is average proportion of heterozygote individuals in the subdivided populations assuming Hardy-Weinberg equilibrium?
HS = 0.41
What is the expected frequency of heterozygotes assuming Hardy-Weinberg equilibrium if population structure is ignored?
HT = 0.455
p1=0,5
p2=0,2
mean p=0,35
HT=2p(1-p)=2*0,35(1-0,35)=0,455
In an experimental population of Dung flies, body length shows a continuous distribution with a mean of 6 mm. A group of males and females with a mean body length of 9 mm are removed and interbred. The body length of their offspring average 8 mm. From these data calculate the heritability in the narrow sense for body length in this population using the breeder’s equation.
h^2 = 0.66
[9-6 = 3 (after selection) 8-6 = 2]
Consider the code table below and assign the correct answer (A, B, C, D) to the blank on the left.
Which of the folllwing mutations of the coding strand sequence 5’ - TAC - 3’
A) TAC -> TAT
B) TAC -> TAG
C) TAC -> CAC
D) TAC -> TCAC
are
missense mutation
frameshift mutation
non-sense mutation
silent mutation
missense mutation = C
frameshift mutation = D
non-sense mutation = B
silent mutation = A
cDNA microarrays are used primarily in which field of “omics”?
a) Transcriptomics
b) Proteomics
c) Interactomics
d) Metabalomics
Which species concept is based on reproductive isolation?
a) Genic
b) Biological
c) Morphological
d) Evolutionary
Which of the following species’ genomes contains the greatest number of homologs to human disease-related genes?
a) E. coli
b) S. cerevisiea
c) D. melanogaster
d) C. elegans
Which biogeographic model of speciation involves complete geographic isolation?
a) Allopatric
b) Sympatric
c) Parapatric
d) Polypatric
Which hypothesis can explain the observed correlation between DNA polymorphism and recombination rate?
a) Haldane’s rule
b) Dominance
c) Balancing selection
d) Background selection
Which of the following observations would suggest recent, positive selection in a region of the genome?
a) low frequency allele, low linkage disequilibrium (LD)
b) low frequency allele, high linkage disequilibrium (LD)
c) high frequency allele, low linkage disequilibrium (LD)
d) high frequency allele, high linkage disequilibrium (LD)
Which of the following can be used to “knock-out” gene expression?
a) Codon bias
b) cDNA microarrays
c) Proteomics
d) Homologous recombination
Genes that share homology due to speciation are known as?
a) Orthologs
b) Paralogs
c) Pseudogenes
d) Pseudologs
C) 1-D. 2-A, 3-B, 4-C
Which of the following DNA sequence changes is a transversion?
a) A -> C
b) C -> T
c) T -> C
d) G -> C
e) G -> A
other transversions are: C -> A, T -> G, G -> T
Darwins biological views were influenced by…
A) the writings of Gregor Mendel
B) his work as a naturalist aboard the H.M.S. Beagle
C) his military service
D) the theory of plate tectonics
E) correspondence with Ernst Mayr
Biological evolution is defined as…
A) change in the properties of organisms over the course of development
B) direct change toward a fixed goal
C) the belief that each organism has an immutable essence
D) change in the properties of groups of organisms over the cause of generations
E) A completely random biological process
Who proposed the organizational principle of binomial nomenclature?
A) Carl Linneus
B) Jean-Baptiste Lamarck
C) Aristoteles
D) Charles Darwin
The binomial system of biological nomenclature (species grouped in genera and orders)
What is the Modern Evolutionaty Synthesis?
A) The introduction of genomics into evolutionary biology starting with the publication of the human genome in 2001
B) The merger of geologists’ transformation theory (e.g. Charles Lyell) with organismal change (e.g. Charles Darwin, Russell Wallace) in the 19th century
C) The synthesis of hitherto disjunct biological disciplines in the mid 20th century
D) The merger of Darwinian ideas with Medelian principles in a mathematical framework
also
C) The synthesis of hitherto disjunct biological disciplines in the mid 20th century?
Who made the first X-ray crystallography of the structure of DNA?
Rosalind Franklin / Raymond Goslin (took the photo)
Two species of muntjacs (barking deer) that are phenotypicall similar have very different karyotypes (23 vs. 3 or 4 chromosome pairs, depending on the population). What processes might have caused this difference?
A) Inversions
B) Fissions and Fussions
C) Deletions
D) Frameshift mutations
E) Backmutation
??
Down syndrome (trisomy-21) is an example of…
A) Diploidy
B) translocation
C) fusion
D) aneuploidy
E) polyploidy
(chromosomal anomaly in which the number of one or more chromosomes is abnormal (extra copy of / missing a chromosome)
Diploidy = having two sets of chromosomes
Polyploidy = heritable condotion of possessing more than two complete sets of chromosomes (common in plants)
What is the order of magnitude for the mutation rate (per generation) of the human-chimp lineages?
A) 1e-05
B) 1e-08
C) 1e-09
D) 1e-11
1e-09 would be per year
You observe a population of 40 mice that differ in coat color. 20 are black, 10 are white and 10 are intermediate grey. Write down possible genotypes for each color morph assuming a single locus with a co-dominant genetic architecture. What is the frequency of the underlying alleles?
A) 5/8 and 3/8
B) 7/9 and 2/9
C) 0.1 and 0.9
D) 5/8 and 6/8
E) 0.5 and 0.5
F) 0.3 and 0.7
In humans, the mutation rate of the X-chromosome is expected to be… (multiple answers possible)
A) higher than in autosomes
B) lower than in autosomes
C) higher than in the Y chromosome
D) lower than in the Y chromosome
You observe a population of 40 mice that differ in coat color. 20 are black, 10 are white and 10 are intermediate grey. Write down the possible genotypes for each color morph assuming a single locus with a co-dominant genetic architecture. What is the frequency of the underlying alleles?
A dominant mutation A changes coat color in (diploid) mice from white to black. In a population sample you count 16 white mice and 128 black mice. Assuming the population is in Hardy-Weinberg-equilibrium what is the relative genotype frequency of the heterozygote mutants?
0.4444
frequency of aa: 16 of total of 16+128
f_aa = 16/(16+128)
f_aa = 0.111
allele frequency = root of 0.111 = 0.333 = f_a
f_A = 1 - f_a
2 * f_a * f_A = 0.44
In an electrophoretic study of enzyme variation in a species of grasshopper, you find 62 A1A1, 49 A1A2 and 9 A2A2 individuals at a particular locus in a sample of 120.
What are the genotype frequencies for A1A1, A1A2, and A2A2?
A) A1A1 = 0.52, A1A2 = 0.41, A2A2 = 0.08
B) A1A1 = 0.44, A1A2 = 0.66, A2A2 = 0
C) A1A1 = 0.49, A1A2 = 0.26, A2A2 = 0.25
D) A1A1 = 0.39, A1A2 = 0.034, A2A2 = 0.027
62/(62+49+9) = 0.52
49/(62+49+9) = 0.42
9/(62+49+9) = 0.08
What is the allele frequency of allele A1?
= 0.72
f_A1 = (62+(49/2))/120 = 0.72
Does the population deviate strongly from Hardy Weinberg equilibrium?
Tip: f_A1 = 0.72
Yes (?)
f_A2 = 1 * f_A1 = 0.28
f_A1A1 = f_A1 ^ 2 * 120 = 62.35
f_A1A2 = 2 * f_A1 * f_A2 * 120 = 48,296
f_A2A2 = f_A2 ^ 2 * 120 = 9,35
A small population of three-spined stickleback fish which you estimate to be in their hundreds lives in an Alaskan lake. Two alleles segregate at a neutral locus (A and B). The allele frequency of the A allele is 0.78. Which of the following allele frequencies would most likely be found in the next generation?
A) 0.50
B) 0.51
C) 0.79
D) 0.90
E) 0.10
A population changes in size from N to 10N to 100N in three generations. What is the effective population size?
3 / (1/1 + 1/10 + 1/100) = 2.7
(ist glaub nicht ganz richtig weil wir die letzte Generation in der Berechnung weglassen, aber macht hier bei dem Ergebnis keinen Unterschied)
The expected number of generations it takes until all lineages from a sample of size n share a single most recent common ancestor…
A) Is independent of the sample size n
B) Is independent of the population size
C) Is always smaller than twice the population size
D) Is always larger than twice the population size
Which of the following statements is incorrect?
The expected waiting time for any two of k lineages derived from a sample of size n to coalesce…
A) is longer further back in time
B) is longest for the last two lineages furthest back in time
C) is dependent of the population size
D) is shortest just before the most recent common ancestor
You calculate F-statistics for a set of two subpopulations in a diploid organism. In subpopulation 1 you find FIS to be negative. What does that mean?
A) The number of heterozygotes in subpopulation 1 is higher than expected under Hardy-Weinberg-equilibrium
B) The number of heterozygotes in subpopulation 1 is lower than expected under Hardy-Weinberg-equilibrium
C) There is evidence for migration from subpopulation 1 into subpopulation 2
D) Allele frequencies differ between subpopulations
???
Consider two populations with allele frequencies p1 = 0.2 and p2 = 0.4. What is FST?
0.4
or 0.0476? <-
Hs1 = 2x0.2x0.8
Hs2 = 2x0.4x0.6
mean(Hs1, Hs2) = 0.4
Hs = 0.4
Paverage/total = mean(0.2, 0.4)
Pt = 0.3
Ht = 2x0.3x0.7 = 0.42
1 - (Hs / Ht) = 0.0476
The color of a species of snail is determined by a single autosomal locus. AA homozygotes are red, AB heterozygotes are pink, and BB homozygotes are white. Genotypic fitnesses are as follows: wAA = 0.5, wAB = 1.0, wBB = 0.75. At equilibrium
A) both alleles are equally frequent
B) both alleles segregate, and allele A is more common than allele B
C) the population is fixed for allele
D) the population contains only AB heterozygotes
E) both alleles segregate, and allele B is more common than allele A
In a diploid population with alleles A and a the aa genotype has a selective disadvantage (s) of 40%. The dominance coefficient in heterozygotes (h) is 25%. What is the fitness of the three genotypes?
a) wAA = 1, wAa = 0.25, waa = 0.6
b) wAA = 1, wAa = 0.25, waa = 0.4
c) wAA = 1, wAa = 0.9, waa = 0.4
d) wAA = 1, wAa = 0.9, waa = 0.6
What is the Modern Evolutionary Synthesis?
A rodent species has a population in one area of 100.000 individuals, and the per-gene mutation rate is 10-6. The average heterozygosity of this population is 0.29. Another population of the same species has twice as many individuals (200.000). Assuming equilibrium, what would you expect the average heterozygosity of the second population species to be?
A) 0.58
B) 0.44
C) 0.29
D) 0.14
E) 0.91
But why?
Mutations that change one body part into another are known as:
Homeotic
Semi-transformative
Ontological
Pseudo-transformative
Concerted
The 2R hypothesis states that _______ during vertebrate evolution.
The whole genome duplicated twice
The Hox cluster was reduced two-fold
The whole genome was reduced two-fold
The Hox cluster duplicated twice
There were two mass extinctions
The „Fast-X“ effect is expected when beneficial mutations are:
Dominant
Overdominant
Recessive
Rare
Common
3) Recessive
Which of the following cannot be performed using only within-species polymorphism data?
Hudson-Kreitmann-Aguade (HKA) test
Hudson’s haplotype test
Haplotype number test
Haplotype diversity test
Tajima’s D test
1) Hudson-Kreitmann-Aguade (HKA) test
-> HKA requires both polymorphism and divergence data
Haplotype and Tajima’s D test requires only intrasepcific polymorphism data
Methodologically, neighbor-joining is most similar to:
Maximum likelihood
Parsimony
UPGMA
Maximum branching
Bayesian reconstruction
3) UPGMA
27. In birds, the mutation rate of Z chromosome is expected to be
C) higher than in the W chromosome
D) lower than in the W chromosome
E) 1/3 of the rate in autosomes
F) 1/4 of the rate on the W chromosome
Answers B, D and F
Answers A and C
Answers B and D
Answers D and F
Answers A and D
maybe E) or F)
28. Consider two populations of equal size with the following genotype frequencies AA, Aa and aa. Pop 1: 5, 10, 5. Pop 2: 3, 10 ,7. What is FIS for population 1 and 2 and FST (FIS_1/FIS_2/FST, rounded by two digits)?
0.00 / 0.00 / 0.00
0.10 / -0.10 / 0.10
0.00 / -0.04 / 0.01
0.02 / 0.04 / -0.04
0.07 / 0.00 / 0.03
3) 0.00 / -0.04 / 0.01
Last changed4 years ago