1a) Difference between an analytical and a preparative technique.
In analytical chromatography the purpose is to separate the components of the sample. The point is to analyze a substance in detail and gather information about it. This approach can provide a qualitative profile of the sample. The purpose of preparative chromatography is to isolate and purify quantities of a specific substance from the sample.
1b) You are given a sample composed of 3 compounds A to C with different polarities. The sample is loaded onto a C18 reverse phase column and eluted with 30% methanol in water. After eluting with 10 mL of solvent and collecting 1 mL fractions, compounds A and B are found to be in the 3rd and 6th fractions, respectively. Which compound is more polar A or B? Is compound C more or less polar than A and B? Justify your answer.
In the reverse phase chromatography, the stationary phase is hydrophobic (non-polar) while the mobile phase is hydrophilic (polar). The first eluted compound will be the less hydrophobic (more polar). Therefore the order from more polar to less is: A-B-C because its assumed that the compound C is still bonded to the matrix.
è The more hydrophobic the compound the easier it goes through the matrix as it is less bonded in the matrix compared to hydrophilic compounds
è Matrix = agarose hydrophobic groups in high density in agarose gel
è Salting out as salt makes the solution more hydrophobic (to enhance hydrophobic interaction)
After eluting with another 10 mL of 30% methanol in water compound C has still not eluted. Describe how would you obtain compound C.
It would be necessary to adjust the polarity of the mobile phase for it to be able to wash the compound C. For example adding a higher concentration of organic solvent (methanol) (à to enhance breaking of Hydrogen bonds)
not sure: It would be necessary to adjust the polarity of the mobile phase for it to be able to wash the compound C. For example adding a higher concentration of organic solvent (methanol) (à to enhance breaking of Hydrogen bonds)
In the first graph we likely used a highly potent organic solvent, because every molecule eluded pretty fast, while in the second graph, every molecule comes in a different time, meaning we used a lower potency solvent, that gave every molecule enough time to bind properly.
not sure: What kind of chromatography is used to purify a His-tagged protein or enzyme and what is the main feature of this chromatography? Describe the ligands to bind the target protein and elution conditions used to purify the two proteins.
We would choose affinity chromatography that is based on the affinity of said proteins to a certain substrate. For His-tagged protein we prefer IMAC that depends on the affinity of the protein to Cu, and we use imidazole as the organic compound to elude the protein, while for an enzyme we refer to the specific protein-substrate interaction. More likely, we would elude it with glutathione, instead of imidazole.
è Histidine from protein binds to metal (which is in solid phase) and imidazole is used to remove it from solid phase
Out of 3 proteins (A, B, C) with pI's 3,5 and 7 respectively, which are likely to bind to a cation or an anion exchange column with running buffers at pH 5, 7 and 8? Please choose one column and one pH value for the running buffer to separate the 3 proteins in one chromatographic step. Explain how you run the chromatography.
- pI = PH à no charge
- pI > pH à positive
- pI < pH à negative
- pH should be higher than all proteins pH so 8 (7 first, 5 second, 3 last = has strongest bond)
For proteins with pI lower than 7, we prefer cation exchange chromatography, for them to bind easily in a neutral eluent, that will not denature any protein and for the protein with pI 7, we can use either cation with pH 8 or anion exchange with pH 5. If we want to separate them all in one chromatographic step, the best choice would be to use a cation exchange chromatography with pH 8, so that every protein can bind. The protein with pI 7 will come first, then as we add our eluent the protein with pI 5 will come second and the one with pI 3 will bind the strongest and will come last.
a) Define and describe the kind of ELISA shown below. Highlight one advantage of this set up.
Indirect competitive
The imagen shows an indirect competitive ELISA. First, a microplate is coated with appropriate antigens. Sample containing primary antibody is added into the microplate and allowed to react with the coated antigen. Any free primary antibody is washed away and the bound antibody to the antigen is detected by adding an enzyme conjugated secondary antibody that binds to the primary antibody. Unbound secondary antibody is then washed away and a specific substrate for the enzyme is added. Enzyme hydrolyzes the substrate to form colored products. The amount of colored end product is measured. One advantage would be the increased sensitivity, since more than one labeled antibody is bound per primary antibody.
. What are the advantages of doing this sandwich ELISA compared to the first set up shown above?
. The advantages of this method would be the high specificity, since two antibodies are used the antigen is specifically captured and detected (with the indirect ELISA cross-reactivity might occur with the secondary antibody, resulting in nonspecific signal) and that it is suitable for complex samples, since the antigen does not require purification prior to measurement (which will be needed before indirect ELISA).
One of the above situations requires monoclonal antibodies. Which one? Justify your answer explaining what the difference is between a polyclonal and a monoclonal antibody.
Monoclonal antibodies recognize a single epitope that allows quantification of small differences in antigen while polyclonal antibodies recognize multiple epitopes. Using monoclonal antibodies to attach the antigen to the microplate, eliminates the need to purify the antigen before the measurement, simplifying the assay and increasing the specificity of it.
a) What pH value will you choose to purify protein A (charge identified by the solid line in the figure) using anionic exchange chromatography? Justify your answer.
Distinguish from dead cells:
- Not directly possible but you can dye the sample with f.e. trypan blue as it distinguishes the dead from the living cells (only dyes dead cells and therefore living cells can be counted)
- pH value between 5.2 and 7.9
- if pH >pI protein is negatively charged and binds to positive charged matrix
o to avoid other protein to bind, the pH should be lower than its pI (from protein B)
- pH = pI à no charge
- pH > pI à negatively protein charged
- pH < pI à positively protein charged
And if you want to separate protein A from protein B (dotted line) using the same kind of chromatography, what pH value will you use? Explain the proteins’ behaviour in the chromatographic column at the pH value you have chosen
- We need a pH higher than pI of both proteins (>8) to charge both proteins negatively and to therefore purify
- For the purifying process, salt is added and the protein with the higher pI (à Protein B) will elute first as it is less negatively charged
- At higher salt concentrations, protein A will elute
or:
To separate the two proteins from each other, the pH used will be the same, 5.7-6.2. Like this,
protein A will have a net negative charge and protein B will have a net positive charge in the
buffering solution.
In the chromatographic column protein A will stick while protein will be repelled due to their
charges. This means that while protein A attaches in the column to the stationary phase,
protein B will remain in the mobile phase, in the flow through.
a) SDS-Page is an acronym to 3 specific componentes (SDS, PA and GE). Indicate what SDS-PAGE stands for and briefly describe the role of SDS.
- SDS = sodium dodecyl sulfate
- PA = polyacrylamide
- GE = gelelectrophoresis
- Protein separation by mass, proteins are coated with SDS as it is negatively charged
- They move towards positive pole and are separated according to their size only, not according to their charge (as bc of SDS every molecule is negatively charged)
- (They are then compared with markers who have a specific size (= molecular weight) to identify samples molecular weight)
a) Describe how you denatured the proteins used for SDS-PAGE.
- Proteins are denatured by using the salt SDS
- Function à SDS = assign negative charges to protein AND to denature proteins
- Also: dithiothreitol is used to reduce disulfide bonds in protein
- 1.4 g of SDS per g of protein is used
a) What substance in sample loading buffer is responsible for breaking disulfide bonds and why it is important to break those bonds.
- dithiothreitol (DTT) is used to reduce disulfide bonds in protein
- to destroy tertiary structure of protein and to help get a linear structure to help distinguish their size
a) What is the main objective of these methods? What biological relevant information can you obtain with these methods?
- Normal PCR à to synthesize DNA/RNA
o and to identify if dna/rna is 1. present and the size of the DNA/RNA (1. and 2. determined in electrophoresis)
- rtPCR à to get the DNA/RNA quantity, to recalculate the amount of DNA/RNA present in sample. As dna is marked with fluorescence molecules (or similar), in every cycle the value can be determined (mostly in threshold value) and comparing with control group (where DNA amount from beginning is known) you can therefore get beginning amount of DNA in your samples
- relevant information: to obtain rapid and sensitive determination and quantitation of nucleic acid in various biological samples (f.e. used for water samples, described as eDNA sampling or for covid tests to get the amount of viral infection)
b) Name the two methods and state the differences between them.
- DNA probe-based real-time PCR = specific, as the probe is sequence specific for DNA parts
o uses rt fluorescence (from 5’-3’ exonuclease cleavage of a fluorescently-labeled) of a target-specific probe to measure DNA amplification at each cycle of a PCR à light during extension
o strands are broken up, the probe binds to a specific sequence, in elongation phase, the taq polymerase synthesizes the new dna strand and destroys the probe sequence.
o The sequence molecule is released and in an exited state, consequently emitting light à the more synthesized dna the more light is emitted
- Fluorescent dye-based rtPCR = unspecific as it incorporates in every kind of DNA
o bsp: sybr green
o rt fluorescence of dsDNA binding dye to measure dna amplification as it occurs during pcr (displays fluorescence and increases as dna increases)
o emits fluorescence when incorporating into ds DNA
o fluorescence signal increases as more ds dna molecules are generates/synthesized
o à light after annealing is done (extension)
b) Is there any additional advantage in one compared to the other? Justify your answer.
b) Based on the plot below and in the equation CT = - 3.1 x [DNA] (ng/µL) + 25.0 , calculate the DNA concentration for samples depicted by the red and black traces.
- [DNA] (ng/µL) = (CT – 25) / -3.1
- Red: CT = 14
o [DNA] (ng/µL) = (14 – 25) / -3.1
o = 3.54 ng/µL
- Black: CT = 22
o [DNA] (ng/µL) = (22 – 25) / -3.1
o = 0.96 ng/µL
The figure below shows the light path of an epifluorescence microscope, where number 1 is the light source which can be a laser or a Xenon lamp, for instance.
1 = light source
2 = excitation light (shorter wl as emission light but stronger) à “first light”
3 = emissions light (light which is emitted by organism, longer wl and weaker light)
a) Why a fluorescence microscope requires the use of an epifluorescence (or incident light) configuration instead of transmitted light?
- Incident = light shines from above on to sample and directed back up to objective again
- Transmitted light = source from below going through object/sample and light which Is left/going through sample is directed towards objective
-
- We need to use incident light as we are working with fluorescence organisms = meaning that they emit light when in excited state
- We don’t want to see light shining through organisms but rather the light created by organisms (= emitted by organism)
- If we would use transmitted light, this light would be stronger/brighter than fluorescent light emitted by the organism
a) The arrows numbered 1-3 show the light path in the microscope (four arrows numbered 2 for the excitation light and three arrows numbered 3 for the emission light). Point in the figure what arrow could eventually be eliminated by a better choice of filter B. Justify your answer.
- Want to achieve mirror which only lets through emission light for better resolution (if excitation light goes through, fluorescence light from organism f.e. is not seen well)
- à choose mirror which reflects excitation light and transmits (lets through emission light from specimen/sample
- Get rid of arrow 2 which is above the mirror
a) The figure below plots the excitation (absorption) and emission spectra of GFP. Based on the filter list below, choose one filter from each category to image GFP using a fluorescence microscope. Justify your answer referring to the function of each filter category.
Center λ / Full width at half max.
Excitation filter (band pass) 390/18 nm
434/17 nm
469/35 nm
497/16 nm
559/34 nm
Emission filter (band pass) 460/60 nm
479/40 nm
525/39 nm
535/22 nm
620/52 nm
Reflection band / transmission band
Dichroic filter (long pass) 360-407/425-575 nm
423-445/460-610 nm
452-490/505-800 nm
490-510/525-700 nm
525-556/580-650 nm
- GFP
o Abs = 484 nm
o emission = 507 nm
o stoke shift = 23 nm
o abs rate should be slightly lower (to the left) = excitation filter
o emission rate should be slightly higher (to the right) = emission filter
- Dichroic filter: reflects one and transmits other
o à 452-490/505-800 nm
- Emission filter B: 525/39 nm
- Excitation filter A: 469/35 nm
- Reason: should include both: emission and absorption of gfp as well as their stoke shift, therefore for the filters we use an emission filter being slightly higher than emission rate peak and excitation filter being slightly lower than absorption rate peak, the stoke shift should be lower than full width at half max
- The dichroic filter reflects the excitation light and transmits the emission light
identify and describe real time pcr
- It works like the normal pcr but additional fluorescence dye is added to determine the actual increase of the dna within the sample (makes a “picture” after every cycle and with a reference – a positive control the beginning dna concentration can be calculated) à therefore 3 types can be used: tagman, molecular beacon, SYBR green
- Ingredients:
o Buffer (magnesium and calcium mostly) to provide suitable chemical environment for the dna polymerase (pH wert)
o DNA Polymerase (taq): bind nucleotides together to synthesize dna
o Primer f and r: starting sequence for polymerase to bind on template
o Template: dna sample which is going to be synthesized
o dNTPs: nucleotides used to quantify dna
o fluorescence dye: to detect the quantity of the dna for each cycle
- how pcr works:
o denaturation: breaking hydrogen bonds (breaks DS dna) à 95°C (2min)
o cycle: ca 30 rounds:
§ denaturation: breaking hydrogen bonds (breaks DS dna) à 95°C (30s)
§ annealing: primer can bind on dna 55°C (30s)
§ elongation: taq polymerase can bind on primer and starts synthesising complementary dna strang with dNTPs 70°C (2 min)
o final elongation: This step allows the polymerases to finish reading whatever strand they are currently on
a) Design the primers to amplify the ribosomal DNA knowing the gene sequence below.
5’ CCTCAGTGAGATTGTAGTGC………GGACATTTGATTACCTTTGCAC 3´
5’ CCTCAGTGAGATTGTAGTGC 3’
5’ GTGCAAAGGTAATCAAATGTCC
Forward Primer here: (anneals to 5 to 3 and is 3´primer):
5’ CCTCAGTGAGATTGTAGTGC 3’ (20) (anneals on antisense chain)
Reverse Primer here: (anneals from 3 to 5 and is 5´primer):
5’ GTGCAAAGGTAATCAAATGTCC 3’ (22) (anneals on template/ sense chain)
Normally both primers bind on 3’ end (on both strands of dna) and start therefore with 5’
a) The PCR product was analysed by gel electrophoresis. What sample contain the algae Alexandrium spp? Justify your answer. (320 bp)
The algae is found in 1 and 6 as well as in sample 3 and 4, but there is additional DNA seen (maybe contaminated). As stated before the DNA of the algae contains of 320 bp and with the ladder the dna size of 320 bp is seen in sample 1,3,4 and 6.
a) Quantify the number of DNA copies from the algae Alexandrium spp present in the sample that gave the yellow trace in the plot above. Show your calculations if justified.
è How much dna is in the algae
Read the CT value in the threshold, put it in the graph stated in log copy number and calculate x
CT threshold: 21
Calculation: y = - 3.44 x + 34.04
21 = - 3.44 x + 34.04
-13.04 = - 3.44 x
3.79 = x (in log 10) à number of DNA copies = 10^3.79 dna copies
(Concentration: log 10 à 0.34 ng/ µL)
a) What technique is shown in the figure? Explain the technique and its objective.
1. Plate is coated with capture AB (prim ab)
2. Sample is added and any antigen binds to capture AB
3. Detecting AB (sec ab) added and binds to antigen
4. Enzyme linked sec AB (detecting AB) (=Biotin) is added and binds to detecting antibody
5. substrate is added (streptavidin-HRP), and is converted by enzyme to detectable form (color)
The technique used is a Sandwich ELISA. An ELISA is short for Enzyme-linked Immunosorbent assay. The objective of an Elisa in general is to quantify the amount of antigen/ target protein present in our sample. This can be done with various techniques. In this case, the sandwich ELISA, we have a well coated with capture antibodies that are specific to our antigen we want to detect in the sample. Next, the sample, with potentially the antigen, is added and the capture antibodies allow only to bind antigen/ proteins with a specific sequence and other proteins will remain in the liquid phase and are being washed out after incubation. Next, secondary antibodies are added. These have to be from a different organism than the primary antibody -> the primary antibody is inserted in the other species and is an antigen there. The organism produces antibodies against it. Now we have a secondary antibody specific to the primary antibody of another species.
When the secondary antibodies are added, they bind to an epitope of the target protein/ antigen. In case of sandwich ELISA, both antibodies are polyclonal as they bind to specific sequences on different epitopes of the antigen.
Next, the soluble compounds are washed out and only the double antibody/ antigen pair remains. The secondary antibody is joined with the streptavidin-biotin pair (protein + vitamin), which emits light when joined in a complex.
a) What is the advantage of using a capture antibody?
The advantage is, that a complex mixture of proteins does not have to be purified before doing the ELISA. The capture antibody only captures the specific target protein and all other soluble compounds can be washed out.
- More specific bc only target protein will bind (antigen is immobilized to a solid surface)
- a 'capture' antibody is bound to the well first, and when the sample is added, only proteins the antibody recognizes are 'captured'.
- The sample can be washed and the other components separated from the captured antigen/protein etc.
a) What are the main characteristics and advantage of using the pair streptavidin-biotin in your assay?
- Main characteristics: biotin = water soluble B-vitamin (coenzyme for carboxylase enzyme), streptavidin: protein purified from bacterium streptomyces avidinii
- binding of streptavidin to biotin is well known for the strong noncovalent interaction with femtomolar affinity à high affinity, slow exchange rate, and good specificity of the biotin–streptavidin interaction has resulted in a wide range of biotechnological applications including extracellular and in vitro labelling, therapeutics, biosensing and biofunctionalization. The large range of biotinylated small molecules, peptides, proteins, antibodies and nucleic acids as well as materials adds to the diversity of the biotin–streptavidin chemistry
- Enables amplification of weak signals and improves detection sensitivity for medium and low abundance targets with simple workflow
- Versatility
a) Below is the standard curve of your assay to measure the concentration of the antigen (target protein) in a sample. What is the concentration of the antigen in a sample giving an absorbance of 1.2? Show your calculations.
- calculation: 1.2 = absorbance (y)
- find x
- 1.2 = 0.2843 x + 0.0775
- x = 3.95 ng/ml
a) Describe the procedure and the rational for the method shown below. Any disadvantage foreseen for this method?
- = spread and pour plate
- Dilute samples: dilutions are spreaded out on agar plate, and colony forming units are counted after incubation time (cell colonies can start to grow from single cells)
- The number of counted cells (CFU) are up calculated to the dilution rate to get the exact beginning cell number
- Errors: not immediate answer and therefore might be in a different phase already when counted
o Also not 100 % known if cfu starts from single cells
- Sample dilution to maintain single bacterial cells instead of aggregated cells which grow on the plates
b) Calculate the cell concentration in the original cell suspension. Show your calculations.
- Plate 1: 1/1000 à dilution of 10^-3 à 49
- Plate 2: 1/10.000 à dilution of 10^-4 à 5 cells
- Plate 1: 1/1000 à dilution of 10^-3 à 49 = 49x10^3 = 49000
- Plate 2: 1/10.000 à dilution of 10^-4 à 5 cells = 5x10^4 = 50000
b) The number of animal cells in your sample was counted by using a counting chamber for microscopy. Knowing the deepness (0.02 mm) and the area (1 mm2) for the 25 central squares on your chamber, calculate the cell concentration in your sample.
First: what is the area of the 25 squares?
è 0.02 mm* 1 mm^2 = 0.02 mm^3
è mm^3 in ml? -> /1000= 0.02/1000= 0.00002 = 2*10 ^4 ml
è We want to calculate cells per ml -> 1 ml/ 0.00002 ml= 50000
è How many cells in the middle square? -> 65
è 65 cells/ 0.00002 ml -> 65 cells * 50000 cells/ ml= 3250000 cells/ ml
countng chamber: Can you use this method to distinguish live from dead cells?
purpose of sds page
An SDS PAGE is used to sort negatively charged molecules depending on their size. This way, we can collect a molecule of a known size and purify it from other molecules. It is also to quantify the molecule (although this is relative and not absolute).
a) Summarize the principles of the technique and list the reasons to use SDS.
The SDS PAGE works as the following: First, an agarose gel has to be made (1. Gel name…). When it is set, a second gel with a lower agarose concentration will be put on top (Stacking gel). The samples are prepared by adding SDS is each sample. Each protein binds to 1.4 g of SDS per gram of protein, this ensures an equal charge of all molecules, so that they will only be sorted according to their size and not their charge. The setup consists of two gels to ensure that the molecules in the samples all have the same starting point when the electricity is turned on. Meaning, the molecules go through the stacking gel (with low friction) in a fast pace and accumulate on top of the … gel. When the electricity is on, all molecules, as all of them have a negative charge, go in direction of the positive electrode. Friction in this gel is higher, so that smaller molecules go further than larger ones.
a) Estimate the approximate MW of the most intense protein band in sample C. Does it match with the plot shown below? Justify your answer namely by plotting the data in the plot bellow.
Around 30kDa in C -> 3x10^4?? It would match and would be assigned to the Carbonic Anhydrase
qpcr
The technique used is a real time PCR. All necessary components are mixed together: primers, as starting sequences for the Taq-polymerase, dNPTs, free bases, Taq-polymerase, enzyme that synthesizes new DNA strand, buffer, for a suitable environment for the Taq-polymerase to work, template, sample to be multiplied, TaqMan probe, fluorescent dye binding to the DNA and consequently emitting light.
Then, the sample is heated to around 90 degrees to break the disulfide bridges of the double-stranded DNA. Next, it is cooled down to 55 degrees, so that the primers can bind to the complementary sequence on the DNA as well as the TaqMan probe. Next, it is heated to 70 degrees, which is the optimal temperature for the Taq polymerase to work. It binds onto the primer sequences and starts to synthesize the new DNA strand by connecting complementary dNPTs. When the enzyme reached a sequence where the TaqMan probe is bound, it destroys it and consequently the fluorophore goes into an exited stage and emits light. When the Taq polymerase reaches a stop sequence, it comes off of the DNA strand. The newly synthesized strands can now connect to each other and build disulfide bridges. A new double stranded DNA is formed. Each cycle of PCR doubles the amount of DNA templates. It is exponential.
a) What is the main purpose of this technique? qpcr
The main purpose is to quantify the amount of different DNA sequences present in your sample which can be done by amplification of the DNA.
a) Imagine that you stop the qpcrafter 33 cycles (vertical dotted line) and run an agarose gel. Can you conclude about the initial amount of target cDNA in your sample through analysis of the agarose gel? Justify your answer.
No, an agarose gel only gives you a relative estimation of the DNA, if the band is thicker/ stronger, there is more DNA than in a lighter band, and not the absolute amount of DNA.
a) The horizontal orange line is the point where the fluorescence passes the threshold. The initial amount of target cDNA in your sample that lead to the cyan curve is 1000 ng/µL and you have performed a serial 10 fold dilution of this sample to obtain the magenta, blue, red, orange, green and pink curves. Calculate the concentration of target cDNA in a sample whose Ct is 27 cycles.
Cyan curve: 1000 ng/µL gets to threshold at 15 CT
1000 à 15
100 à 19
10 à 22
1 à 25
0.1 à 29
0.01 à33
0.001 à 36
Ct=27
Initial C= 1000 ng/µL
1:10 dilution
1000^27= 1e+81/10= 1e+80
The concentration of cDNA
a) Select the temperatures for a PCR cycle used to the amplification reaction.
Initiation/ denaturation: 92 degrees
Annealing: 55 degrees
Elongation: 70 degrees
a) Design primers to amplify this sequence.
1 atg gtg aga aaa tgg gcc ctg ctc ctg ccc atgctgctct gcggcctgac tggtcccgca
61 cacctcttcc agccaagcct ggtgctggag atggcccagg tcctcttgga taactactgc
121 ttcccagaga acctgatggg gatgcaggga gccatcgagc aggccatcaa aagtcaggag
181 attctgtcta tctcagaccc tcagactctg gcccatgtgt tgacagctgg ggtgcagagc
241 tccttgaatg accctcgcct ggtcatctcc tatgagccca gcacc tga
Forward primer: atggtgagaaaatgggccct
Reverse primer: TCAGGTGCTGGGCTCATA
Briefly describe what you have to do to tag mCherry and what kind of tag was used.
a)What kind of chromatography was carried out?
To tag mCherry, we need to use recombinant DNA technology, because we have to introduce the His-Tag, as the his-tag is not present naturally. This his-tag has Metal affinity, which aids in binding to the Ni lingned membrane later on.
affinity chromatography
b)What you have to do after a SDS-Page to run a western blot?
1. Protein seperation by SDS-PAGE
2. Protein transfer to membrane -> the Gel is next to the membrane in an electrophoretical field à with electricity the proteins migrate onto the membrane
3. Blocking the membrane with a neutral protein (a gel??) and probing (putting) with primary antibody specific to target protein (-> then washed)
4. Probing with labeled secondary antibody specific to primary antibody (secondary one has a fluorescent molecule and binds to primary one) -> when bound, light is emitted
5. Imaging using film, CCD camera or laser scanner
6. Image analysis (software)
You have to transfer the protein to a membrane, together with a membrane (PDVF) inbetween a sandwich frame, which is then placed in a transfer buffer. Before that, you need to block the membrane with (i.e. fat free milk) so that the antibody doesnt bind anywhere. When the sandwich is placed in the transfer buffer, an electrical current moves the negatively charged protein towards the membrane, which sticks to the membrane due to the interaction between the tag and the metal lining.
)Why you have several bands in the top figure and just one in the bottom figure? Estimate roughly the size of mCherry.
The top figure shows the unpurified sample. A Gel Electrophoresis was done to seperate all the diferente proteins in the sample. With the western blot however, we wash out all proteins that are not specific for the two antibodies that are added. Meaning, m-cherry is the only protein that is left in the sample after purifying through a western blot. The size of mcherry is approximately 30 kDa.
Because the His-tag on the protein sticks to the Ni-membrane and the membrane was blocked, so that no other proteins can bind to it.
~30-35kDa
a)Describe the steps and the rational for each step in a) and identify which kind of ELISA is depicted.
A= indirect competitive ELISA
1. Buffered protein sample mixed with unlabelled antibody
2. Pour into antigen coated well
3. Free antibodies, which have not bound to the antigens in the mixture, will bind to antigens at the bottom of the well
4. Wash out
5. Apply enzyme conjugated secondary detection antibody
6. Apply substrate for signal
b) Describe the steps and the rational for each step in b) and identify which kind of ELISA is depicted.
B= direct sandwich ELISA
1. The well is lined with protein specific antibodies/capture antibodies
2. Surface blocking with unreactive protein
3. Introduce buffered protein sample
4. Protein of interest is going to bind to capture antibody
5. Washing out
6. Apply detection antibody, which will bind to protein of interest
7. Detection antibody will be enzyme coupled
8. Apply substrate for signal
What would you expect as output of these assays (direct and indirect elisa)? More or less signal for more dioxins in your sample? Explain.
Indirect ELISA gives a stronger signal because you use a secondary antibody to amplify the signal detected in the photo spectrometer.
The more proteins there are in the sample, the stronger the signal.
More antigen in the sample = weaker signal (less antibody bound to the plate)
The plot bellow shows the % of competition for the ELISA shown in b) when changing the concentration of the enzyme-labelled congener mixed with you sample. Explain the plot. Based on the plot, choose a concentration of enzyme-labelled congener to be used on the quantification of dioxins in an unknown sample
When the concentration of the enzyme-labeled molecule is low, the competition is high. When there is a lot of enzyme-labeled molecules, the competition is low. When we want to quantify the dioxin, we don’t know the amount and want to be able to detect small amounts. So the best would be a higher concentration of enzyme-labeled molecules to decrease the competition and have a weaker signal (0.1) or in the middle (0.01)
The graphs shows the competition of antibodies for antigens until all antigens have formed immunocomplexes and there is no more competition.
0.1 Why 0.1?
Describe the principles and the steps of the experimental technique and what is used for?
The technique is a fluorescent dye-based real-time PCR.
Here, the amount of DNA can be quantified using a fluorescent molecule, which is incorporated into the DNA double-strand.
The Setup is the following: first, all components are mixed together including the DNA template we want to multiply, the taq polymerase, primers, dNPTs, a fluorescente dye (Sybr green for example) and a buffer. Next, the mixture is heated to 90 degrees to break the hydrogen bonds between the bases of the DNA double strand. Next, it is cooled down to around 65 degrees for the annealing of the primers on the complementary sequences on the DNA. Then, it is heated up to 72 degrees, which is the optimal temperature for the Taq polymerase to work. This step is called elongation, where this enzyme binds onto the primer sequences and starts to synthesize a new DNA strand by adding dNPTs. In this step, the The synthesis stops when the polymerase reaches a stopp sequence and let go of the template.
The amplification of the PCR is monitored during the PCR
SYBR Green1: It’s binding to the DNA during the extension phase. During each cycle, more fluorescence is detected.
Haemophilia diagnosis
DNA fingerprinting using variable tandem repeats
Calculate how many times the expression of the heat shock protein 70 increases or decreases in the turtle embryos at 34ºC, 3h, compared with the control condition. Do the same calculation for the 36 ºC, 3h, treatment. Do the results make sense? Justify.
34 °C 3 h à 18 CT to 16.5 CT? tripled ? (not sure …)
36 °C 3 h à 18 CT to 16 CT? vervierfacht quadrupled
b)Does the expression of the heat shock protein 70 increases or decreases with the heat shock? Justify your answer with values.
The expression of the heat shock protein increases with heat shock. While the control group sample reaches the threshold after 18 cycles, the group at 36 degrees reaches the threshold already after 15 cycles. The more cycles a protein needs to reach the threshold in a real time PCR, the smaller quantity of this protein do you have in the beginning. Also, the housekeeping gene 18s shows an increased Ct-threshold value towards a higher temperature, e.g. 6 at 36°C, which corresponds to the lower activity during heat shock
design primers to amplify ribosomal dna
Forward primer (anneals on the antisense strand 3’-5’): 5’ CCTCAGTGAGATTGT 3’
Reverse primer (anneals to the sense strand): 5’ GTGCAAAGGTAATCA 3’
The characteristics are:
- High affinity -> streptavidin has a high affinity for biotin, very tight binding
- High specificity -> one of the most specific interactions in biology, doesn’t interact significantly with other molecules
- Versatility -> can be conjugated with all kind of proteins, antigens, etc.
- Stability -> highly stable and resistant to denaturation, which makes it suitable for various experiments including ph, temperature or denaturation agent extremes
Last changed3 years ago